RegulonDB RegulonDB 10.8: Gene Sequence
ygaM gene sequence


Size: 330        A: 81  T: 71  G: 100  C: 78

Fasta

 

>ygaM E. coli K12. Version NC_000913.3 GI:556503834
atgtttaaccgaccgaaccgcaacgacgttgatgatggcgtgcaggatatccagaatgat
gtcaatcaattagctgacagcctcgaatctgtattgaagtcctggggcagcgacgccaaa
ggggaagctgaagccgcacgcagtaaagctcaggcattgctgaaagaaaccagggcgcga
atgcatggtcgtactcgcgtccagcaagccgcgcgcgatgccgttggctgcgcggattct
tttgttcgtgaaagaccctggtgtagcgtgggtacagcagctgcggtaggtatttttatc
ggcgcactgttaagcatgcgcaaatcgtag
              
                            

Download fasta file
RegulonDB