RegulonDB RegulonDB 10.8: Gene Sequence
nrdH gene sequence


Size: 246        A: 51  T: 64  G: 69  C: 62

Fasta

 

>nrdH E. coli K12. Version NC_000913.3 GI:556503834
atgcgcattactatttacactcgtaacgattgcgttcagtgccacgccaccaaacgggcg
atggaaaaccggggctttgattttgaaatgattaatgtcgatcgcgttcctgaagcggca
gaagcgttgcgtgctcagggctttcgtcagttgccggtagtgattgctggcgatcttagc
tggtctggtttccgtccggacatgattaaccgtctgcatccagcgccacacgcggccagt
gcatga
              
                            

Download fasta file
RegulonDB