RegulonDB RegulonDB 10.8: Gene Sequence
nrdI gene sequence


Size: 411        A: 89  T: 92  G: 121  C: 109

Fasta

 

>nrdI E. coli K12. Version NC_000913.3 GI:556503834
atgagccagctcgtctacttctccagcagctccgaaaacacgcagcgttttatcgaacgt
ttaggtctgcccgcggtgcgcatcccgctcaatgagcgggaacggattcaggtagacgag
ccttacatcctgatcgtgccctcttacggcggcggcggtacggctggcgcggtgccacga
caggtaattcgctttttaaacgacgagcacaaccgggcgttgcttcgcggcgttattgct
tctggtaatcgcaactttggtgaggcgtatggccgcgccggagatgtgattgcccggaaa
tgcggcgtgccgtggctgtaccgttttgaactcatgggtacgcaaagcgatatcgaaaac
gttcgtaaaggagtaaccgaattttggcaacgacaaccgcagaatgcctga
              
                            

Download fasta file
RegulonDB