RegulonDB RegulonDB 10.8: Gene Sequence
ygaZ gene sequence


Size: 738        A: 136  T: 212  G: 198  C: 192

Fasta

 

>ygaZ E. coli K12. Version NC_000913.3 GI:556503834
atggaaagccctactccacagcctgctcctggttcggcgaccttcatggaaggatgcaaa
gacagtttaccgattgttattagttatattccggtggcctttgcgttcggtctgaatgcg
acccgtctgggattctctcctctcgaaagcgtttttttctcctgcatcatttatgcaggc
gcgagccagttcgtcattaccgcgatgctggcagccgggagtagtttgtggattgctgca
ctgaccgtcatggcaatggatgttcgccatgtgttgtatggcccgtcactgcgtagccgt
attattcagcgtctgcaaaaatcgaaaaccgccctgtgggcgtttggcctgacggatgag
gtttttgccgccgcaaccgcaaaactggtacgcaataatcgccgctggagcgagaactgg
atgatcggcattgccttcagttcatggtcatcgtgggtatttggtacggtaataggggca
ttctccggcagcggcttgctgcaaggttatcccgccgttgaagctgcattaggttttatg
cttccggcactctttatgagtttcctgctcgcctctttccagcgcaaacaatctctttgc
gttaccgcagcgttagttggtgcccttgcaggcgtaacgctattttctattcccgtcgcc
attctggcaggcattgtctgtggctgcctcactgcgttaatccaggcattctggcaagga
gcgcccgatgagctatga
              
                            

Download fasta file
RegulonDB