RegulonDB RegulonDB 10.8: Gene Sequence
norV gene sequence


Size: 1440        A: 375  T: 297  G: 392  C: 376

Fasta

 

>norV E. coli K12. Version NC_000913.3 GI:556503834
atgtctattgtggtgaaaaataacattcattgggttggtcaacgtgactgggaagtgcgt
gattttcacggcacggaatataaaacgctgcgcggcagcagctacaatagctacctcatc
cgcgaagaaaaaaacgtgctgatcgacaccgtcgaccataaattcagccgcgaatttgtg
cagaacctgcgtaatgaaatcgatctggcggatatcgattacatcgtgattaaccatgca
gaagaggaccacgctggggcgctgaccgaactgatggcacaaattcccgatacgccgatc
tactgtacagccaacgctatcgactcgataaatggtcatcaccatcatccggagtggaat
tttaatgtggtgaaaactggcgacacgctggatatcggcaacggcaaacagctcattttt
gtcgaaacaccaatgctgcactggccggacagcatgatgacttacctgacaggcgacgcg
gtgctgttcagtaacgatgctttcggtcaacactactgcgacgagcatctgttcaacgat
gaagtggatcagacggagcttttcgagcagtgccagcgttactacgccaatatcctgacg
ccgttcagccgcctggtaacaccgaaaattaccgagatcctgggctttaacttaccagtc
gatatgatagccacttcccacggcgtggtatggcgcgataacccgacgcaaattgtcgag
ctgtacctgaaatgggcggctgattatcaggaagacagaatcaccattttctacgacacc
atgtcgaataacacccgcatgatggctgacgctatcgcccaggggattgcggaaaccgac
ccacgcgtggcggtgaaaattttcaacgtcgcccgaagcgataaaaacgaaatcctgact
aatgtcttccgctcaaaaggcgtgctggtcggcacttcgacgatgaataacgtgatgatg
ccgaaaatcgccgggctggtggaggagatgactggtttacgcttccgtaacaaacgcgcc
agtgctttcggctctcacggctggagcggcggtgcggtggatcgtctttccacgcgcctg
caggatgcgggtttcgaaatgtcgcttagcctgaaagcgaaatggcgaccagaccaggac
gctctgaagttatgccgtgaacacggtcgcgaaatcgcccgtcagtgggcgctcgcgccg
ctgccgcagagcacggtgaatacggtagttaaagaagaaacctctgccaccacgacggct
gacctcggcccacggatgcagtgcagcgtctgccagtggatttacgatccggcaaaaggc
gagccaatgcaggacgttgcgccaggaacgccgtggagtgaagtcccggataacttcctc
tgcccggaatgctccctcggcaaagacgtctttgaagaactggcatcggaggcaaaatga
              
                            

Download fasta file
RegulonDB