RegulonDB RegulonDB 10.8: Gene Sequence
hycI gene sequence


Size: 471        A: 115  T: 102  G: 142  C: 112

Fasta

 

>hycI E. coli K12. Version NC_000913.3 GI:556503834
gtgactgacgttttactctgtgttggcaatagcatgatgggcgatgatggcgcaggtccg
ctgctggcggaaaagtgcgccgccgcgccgaaaggtaactgggtggtgattgacggcggt
agcgcaccggaaaacgacatcgtcgctatccgtgaactgcgcccgacacgactgctgatt
gtcgacgccacggatatggggctaaaccccggcgagatccgcatcatcgacccggatgat
atcgccgagatgtttatgatgactacccataacatgccgttgaattaccttatcgaccag
ttgaaagaagatattggcgaagtgattttcctcggcattcagccggatatcgtcggcttt
tactacccgatgacccagccgattaaagatgcggtagaaaccgtttatcaacgactggaa
ggctgggaaggaaatggcggcttcgcgcagttagcggtggaagaagagtag
              
                            

Download fasta file
RegulonDB