RegulonDB RegulonDB 10.8: Gene Sequence
ygbL gene sequence


Size: 639        A: 150  T: 147  G: 185  C: 157

Fasta

 

>ygbL E. coli K12. Version NC_000913.3 GI:556503834
atgagcgatttcgcaaaagtagagcagtctttgcgagaggagatgacgcggattgccagt
tcattctttcagcgcggctatgcaaccggttcggctggcaatctgtcgctgcttttacct
gacgggaatttactggcgacaccgacaggttcatgcctgggcaatctcgatccgcagcgg
ctttccaaagtcgccgcggatggcgaatggttaagtggtgacaaaccctcgaaagaggtg
ctctttcatctggcgctgtatcgcaacaatccgcgctgtaaagcggtggtgcatttgcac
agcacatggtcgacggcgctttcctgcctgcaagggctggacagcagcaacgttattcgt
ccgttcacaccatacgtggtgatgcggatgggaaatgtcccgctggtgccttattaccga
ccgggcgataaacgcatcgcacaggatctggcggaactggcagcagacaatcaggctttt
ttactggcaaatcatggcccagtggtttgcggtgaaagcctgcaagaagccgccaacaat
atggaagagctggaggaaacggcaaagctgatttttattctcggtgaccgcccgatccgt
tatctgaccgcaggtgaaattgcggaattaaggagttaa
              
                            

Download fasta file
RegulonDB