RegulonDB RegulonDB 10.8: Gene Sequence
ygcR gene sequence


Size: 780        A: 180  T: 166  G: 249  C: 185

Fasta

 

>ygcR E. coli K12. Version NC_000913.3 GI:556503834
atgaacattctgttagcgtttaaagccgaaccggatgccggaatgctggcggaaaaagag
tggcaggcggcggctcagggtaaaagcggaccggatatttcgctactgcgaagtttactc
ggtgctgatgaacaggccgctgccgcgctgctgttggcgcagagaaaaaacggtacgccg
atgtctttaaccgcgttgagcatgggggatgaacgggcattgcactggctgcgctatctc
atggctcttgggtttgaggaagctgtattgctggagacggcggcagatctgcgctttgcg
ccggaatttgtcgctcgccatattgccgaatggcagcatcagaatccgctggatctgata
attaccggctgccaaagcagcgaagggcagaatgggcaaacgccatttttgctggcggaa
atgctgggctggccctgcttcacccaggtggagcgtttcactctcgacgcgctgtttatc
accctcgaacagcgtactgaacatgggttgcgttgttgccgggttcgcttgcctgcggtg
attgccgtgcgtcagtgcggtgaagtggccttgccagtaccgggaatgcgccagcgaatg
gctgcggggaaagcagaaattatccgtaaaactgttgctgccgaaatgccagcgatgcag
tgtctgcaactggcaagagcagagcaacgacgcggagcgacgctgattgatgggcaaacg
gtagcagaaaaagctcaaaagctatggcaggactatttacgccaaaggatgcagccatga
              
                            

Download fasta file
RegulonDB