RegulonDB RegulonDB 10.8: Gene Sequence
ygcS gene sequence


Size: 1338        A: 231  T: 395  G: 368  C: 344

Fasta

 

>ygcS E. coli K12. Version NC_000913.3 GI:556503834
atgaacacttcaccggtgcgaatggatgatttaccgcttaaccgttttcactgccgcatt
gctgcgctcactttcggcgcacacctgaccgacggttatgttctcggcgtcattggttac
gccattattcagcttacgcccgccatgcaactgacgccgtttatggcgggaatgatcggc
ggctcggcgctccttggtttgttccttggcagcctggttcttgggtggatctccgaccat
attggtcggcaaaaaatcttcaccttcagctttttgctgattacgcttgcttcgttttta
caattttttgccaccacgccagagcatcttattggactgcgcattttgattggcattggt
ctgggaggcgattattcagtaggtcacaccttgctggctgaattttccccgcgccgccat
cgcggtattttgctgggcgcattcagcgtggtgtggaccgtaggctatgtgctggcaagt
attgccggacatcactttatttccgaaaacccggaggcctggcgctggctactggcatcg
gcagctctgcccgcgttgttgattacgttattacgctggggaacgccagaatcaccacgc
tggctactgcgccaggggcgttttgcagaagctcacgctatcgtgcatcgctattttggt
ccccatgttttactgggcgatgaagtggtaacggcgacccataaacacatcaaaaccttg
ttctcttcgcgttactggcggcgcacggcgtttaacagcgtcttctttgtctgcctcgta
atcccatggtttgtgatttatacctggctgccaactatcgcccagactattggtctggaa
gatgcgctgactgccagcctgatgcttaatgcgttgttaattgtgggcgcgctgctggga
ttagttctgacgcacctgctggcacatcgcaaatttttgctgggaagttttttgctgctg
gcggcaacgctggtagtcatggcctgtttgccttccggcagttcattaacgctgctgctt
tttgttctcttcagcaccaccatttcggcagtcagtaatctggtgggcattttgcctgcg
gaaagttttcctactgacattcgctcgctgggcgtcggttttgccactgccatgagtcga
cttggcgcggcggtaagtactggcctgctgccgtgggtgctggcgcagtggggaatgcaa
gtcaccttattgctcctggcgacagtgttgttggttggttttgttgtgacctggctatgg
gcaccagaaactaaagccctcccgctggtggcggcgggaaatgtaggaggtgcgaatgaa
cattctgttagcgtttaa
              
                            

Download fasta file
RegulonDB