RegulonDB RegulonDB 10.8: Gene Sequence
ygcU gene sequence


Size: 1455        A: 391  T: 329  G: 374  C: 361

Fasta

 

>ygcU E. coli K12. Version NC_000913.3 GI:556503834
atgtctttatctcgcgcagcgattgtcgaccagctaaaggaaattgttggtgcagatcgc
gtaattaccgatgaaacagtattaaagaaaaacagtattgaccgttttcgtaaatttccg
gatattcatggcatttatactttgccgattccggcagcggtcgtaaaactcggttccaca
gagcaagtatcccgtgtgctgaattttatgaatgcgcacaaaattaacggtgtgccgcgt
accggtgcttccgccaccgaaggtgggctggaaactgttgtagaaaactcggtggtgctc
gacggctccgccatgaatcaaatcattaatattgatattgagaatatgcaggcgacggcg
caatgtggtgttccgctggaagtgctggaaaacgcgttgcgtgaaaaaggttacaccacg
gggcattctccgcagtcaaagccgctggcgcagatgggcggcctggtagcaacccgaagt
atcgggcagttctccacactctacggcgcaatcgaagatatggtcgttggtctggaagca
gtattggctgatggcaccgtcacacgcattaaaaacgtgccacgccgcgcggctggcccg
gacattcgtcacatcatcatcggcaacgaaggtgcattgtgctatatcactgaagtaaca
gtgaaaatctttaaattcaccccggaaaacaacctcttctacggctatatcctggaagac
atgaaaaccggcttcaacatcctgcgtgaaatcatggtggaagggtatcgtccgtcaatc
gctcgtttgtatgacgctgaagatggcacccaacacttcacccattttgccgacggaaaa
tgcgtgctgatctttatggctgaaggtaaccctcgcattgcgaaggtgacgggcgaaggg
attgcggaaatcgttgcccgctacccgcaatgccagcgcgtggacagcaagctgatcgaa
acctggtttaacaacctgaactggggaccggataaagtggctgccgaacgtgtgcagatc
ctcaaaaccggcaacatgggctttaccaccgaagtatccggctgctggagctgcatccac
gaaatctacgaaagcgttattaaccgtattcgtactgagttcccgcacgccgacgacatc
accatgctgggcggtcattcctctcatagctatcagaacggcaccaacatgtacttcgtc
tacgattacaacgtcgttgactgtaagccggaagaggaaatcgacaagtaccacaatccg
ctcaacaagatcatctgtgaagaaaccattcgcctcggcggttcgatggtgcaccaccac
ggtatcggtaaacatcgcgttcactggagcaaactggaacacggcagcgcgtgggcgttg
ctggaagggctgaaaaagcagttcgatcctaatggcattatgaatacgggtactatctat
ccgattgaaaaataa
              
                            

Download fasta file
RegulonDB