RegulonDB RegulonDB 10.8: Gene Sequence
ygcW gene sequence


Size: 786        A: 208  T: 219  G: 196  C: 163

Fasta

 

>ygcW E. coli K12. Version NC_000913.3 GI:556503834
atgtcaatcgaatctctcaatgcgttctcaatggattttttctccctgaaaggtaaaacc
gcaattgttaccggtgggaatagcggtttaggccaggcatttgccatggcgttggccaaa
gctggcgcaaatatctttattcctagtttcgtcaaagataacggcgaaacaaaggaaatg
attgaaaaacagggtgttgaggtggacttcatgcaggtgggtatcaccgcagaaggcgcg
ccgcagaagattatcgctgcttgctgtgagcgtttcggtacagttgatattctggttaac
aatgccggtatttgtaagctgaataaggtgctggacttcggtcgtgccgactgggatccg
atgattgatgtgaacctgaccgccgcattcgagttaagctatgaagctgcaaaaattatg
atcccgcagaaaagcggcaaaattattaatatctgttcattgttctcttacttaggtgga
caatggtcacctgcatattctgccactaaacatgctcttgccgggttcaccaaagcttat
tgtgatgaactaggtcaatataatattcaggtaaatggtatcgcccctggctattatgca
acagatattacgctggcgacacgcagtaatccagaaaccaatcagcgcgttcttgatcat
attccggcaaaccgttggggcgatactcaggatttaatgggcgcagccgtattcctcgca
agtccggcatcgaattatgtcaacgggcatttattagtggttgatggcggttatttagtg
cgctaa
              
                            

Download fasta file
RegulonDB