RegulonDB RegulonDB 10.8: Gene Sequence
ygcE gene sequence


Size: 1479        A: 386  T: 368  G: 405  C: 320

Fasta

 

>ygcE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgaaaaaatacatcatagggattgatggcggaagtcagagcacaaaagtggtgatg
tacgatctggaaggtaacgtggtttgcgaaggcaaaggcttattacagccgatgcacacg
ccagatgccgatactgcagaacatcctgacgacgatttatgggcatcattatgttttgcc
ggtcacgatttgatgagtcagtttgccgggaataaagaagatattgtcggtattggtctg
ggatccatccgttgctgccgtgcgttattgaaagccgatggcacgcctgctgcgccgttg
attagctggcaggatgcacgcgttacacgcccttacgaacacactaaccctgacgtggca
tatgtcacctctttttcgggttatctgacgcatcgcttaaccggcgagtttaaagacaat
atcgccaactattttggtcagtggccggtggattataagagctgggcatggagcgaagat
gctgcggtaatggataagtttaatatcccccgtcatatgctgtttgatgtgcaaatgcct
ggcaccgtcctcggacatatcacaccacaagccgcactggcgacacatttcccggcagga
ctgccggttgtttgtaccaccagtgataaaccggtagaagctctgggggccggattactg
gatgatgaaacggcggtaatttctcttggcacttacatcgcattgatgatgaacggcaaa
gcactgccgaaagatccagtagcgtactggccgattatgtcttctattccgcaaacattg
ctgtatgaaggttacggtattcgcaaaggcatgtggacggtgagctggctgcgcgacatg
ctaggcgagtcgttaattcaggatgccagggcgcaggatctttcaccggaagatttactc
aacaaaaaagcttcttgtgtgccgccaggctgtaatggtctgatgacggtgctggactgg
ctgaccaatccgtgggaaccgtacaaacgcgggattatgatcggctttgattccagcatg
gattacgcatggatatatcgttcgatactggaaagcgtggcgctgacgctgaagaacaat
tacgacaatatgtgtaatgaaatgaatcactttgcgaagcatgtgatcattactggcggc
ggttcgaacagcgatctgtttatgcagatttttgccgacgtgttcaaccttccggcacga
cgtaacgccattaacggttgtgcaagcctgggggcagcgattaatacagcggtaggtctg
gggctatacccggattacgcaacggctgtcgataacatggttcgcgtgaaagatatcttt
ataccgattgagagcaatgccaaacgctacgacgcgatgaataaaggcattttcaaagac
ctaaccaaacatactgatgtgatcctgaaaaaatcgtatgaagtgatgcatggggaattg
gggaatgtggattcgatccagagctggtcgaatgcgtaa
              
                            

Download fasta file
RegulonDB