RegulonDB RegulonDB 10.8: Gene Sequence
ygcG gene sequence


Size: 873        A: 241  T: 273  G: 178  C: 181

Fasta

 

>ygcG E. coli K12. Version NC_000913.3 GI:556503834
atgcgctatttcatactaatgttcactttcgtatgttcctttgttgcagcccaaccaact
attgtcccacaattacagcaacaagttacggatcttacgagtagcttaaactcacaagaa
aagaaagaactgacgcacaagttagaatctattttcaataatacccaagtgcaaattgcc
gtattaattgttcccacaaccaaagacgagacaattgaacaatatgctacaagagttttt
gacaattggcgtttaggagatgccaaacgtaatgatgggatactgatcgttgttgcctgg
tcggatcgcactgtccgcatccaggtaggttatgggctggaagaaaaggtaaccgatgct
ctggctggagatatcatccgtagcaacatgatacccgcatttaaacaacaaaaattagct
aagggattagagctagctataaacgctttgaataaccaactcacttcacaacaccaatat
ccgactaatccttcagaaagtgaatcagcgtcttccagtgatcattattactttgctatt
ttttgggtatttgcagtgatgttcttccctttctggttttttcatcaaggcagtaatttt
tgtcgcgcatgtaaaagtggagtctgtatttcagcaatctatcttttagatttattcctg
ttctccgataaaattttttccattgctgtattttccttcttttttactttcaccatattt
atggtctttacctgtttatgtgtacttcagaaaagagcatctggtagaagttatcattca
gacaacagcggttccgctggaggctcagatagcggcggatttagcggcgggggcggttct
tctggaggtggcggcgcatccggccgctggtaa
              
                            

Download fasta file
RegulonDB