RegulonDB RegulonDB 10.8: Gene Sequence
gudX gene sequence


Size: 1341        A: 300  T: 317  G: 389  C: 335

Fasta

 

>gudX E. coli K12. Version NC_000913.3 GI:556503834
atggcgacacaatccagtcctgttattactgatatgaaagtcattccggtggccgggcat
gacagcatgttgcttaatattggtggggcacataacgcatatttcacccgcaatattgtg
gtactcaccgataacgccgggcataccggcattggtgaagcgccgggcggagatgtgatt
tatcagacgcttgtcgatgctattccgatggttctgggccaggaagttgcgcgactgaat
aaagtggtccagcaggtgcataaaggtaatcaggccgccgattttgataccttcggtaaa
ggtgcctggacctttgaattacgcgttaacgccgtggcggcgctggaagccgctttgctt
gacctgctaggtaaggcgctgaatgttccggtctgcgaactgttagggccaggcaagcaa
cgcgaggctattaccgtcctcggttatctgttttatatcggtgatcggaccaaaaccgat
cttccttatgtggaaaatacgccgggcaaccatgagtggtatcagttgcggcatcagaaa
gcaatgaacagcgaagccgttgtgcgtctggcggaagcctcacaggatcgctacggcttt
aaagatttcaaacttaagggcggcgtgttacctggcgagcaagaaatcgacactgttcgt
gcattgaagaaacgcttcccggatgcgcggattaccgttgatcccaacggtgcatggctg
cttgatgaagccatttctttatgcaaagggctgaatgatgttcttacctatgccgaagat
ccatgcggcgcagaacagggcttctccggacgtgaagtgatggcggaatttcgacgggcg
accggcttgcccgtcgcgactaacatgatcgccaccaactggcgcgaaatgggtcatgcg
gtgatgctcaatgcggtagatattccacttgccgatccgcacttctggacgctttccggt
gcagtccgtgtggcgcagctttgcgacgactgggggctgacctggggctgccattctaat
aaccatttcgatatctctctggcgatgtttacccatgtgggcgcggcggcaccgggtaat
cctaccgctatcgatacccactggatttggcaggagggcgattgtcgcctgacccaaaat
ccgctggagattaaaaacggaaaaattgccgttcctgatgcgcccggtctgggcgtggaa
ctggactgggaacaggtacaaaaggcacatgaggcctataaacgtctgcctggcggtgcg
cgtaacgacgcaggtccgatgcagtacctgatccccggctggacctttgaccgtaaacgt
cccgttttcggccgtcattga
              
                            

Download fasta file
RegulonDB