RegulonDB RegulonDB 10.8: Gene Sequence
yqcA gene sequence


Size: 450        A: 107  T: 106  G: 137  C: 100

Fasta

 

>yqcA E. coli K12. Version NC_000913.3 GI:556503834
atggcggaaattggtatttttgtcggcaccatgtacgggaattcactgttagtggccgaa
gaagcggaagcgattctgaccgcgcagggccacaaagcaacggtatttgaagatcctgaa
ttaagcgactggctgccctatcaggataagtatgttctggtggttacgtccacgaccggg
cagggcgaccttcctgatagcattgtgccactctttcagggaatcaaagatagtctgggc
ttccagccgaatctgcgttatggcgtgattgcgctcggcgacagtagttatgtgaatttc
tgcaatggcggcaaacagttcgatgccttgttgcaggaacagagcgctcagcgggttggc
gaaatgctgttgattgacgccagtgagaacccggaaccggaaacggaatcaaatccgtgg
gtcgaacagtggggcacgctgttgtcctga
              
                            

Download fasta file
RegulonDB