RegulonDB RegulonDB 10.8: Gene Sequence
truC gene sequence


Size: 783        A: 185  T: 175  G: 227  C: 196

Fasta

 

>truC E. coli K12. Version NC_000913.3 GI:556503834
atgctggaaatactctatcaggatgaatggctggttgcggtaaataaaccctccggctgg
ctggttcaccgcagctggctggatcgcgacgagaaagtagtggtcatgcaaaccgtgcgt
gaccagataggccagcatgtttttactgctcatcgtctggaccgacccacttctggtgtg
ttgttgatgggattatccagcgaggccggacggctgctggcacaacagtttgaacagcac
caaatccagaaacgttaccatgcgattgtgcgcggctggttgatggaagaagcggtgctg
gattatccactggtggaagaactggacaaaatcgctgataaatttgcccgcgaagataaa
ggcccgcagccagcagtgacgcattatcgcggtctggcgaccgtagaaatgccggtagcg
accggacgttacccgaccacgcgctacggcctggtggaactggagccgaaaaccggacgc
aaacatcagcttcgccgacatcttgcccatttgcgtcatccgattattggcgatagcaaa
catggcgatttacgccagaatcgcagcggtgctgagcattttggcctccagcggttaatg
ctacatgccagtcagttgtcattgacgcatccttttactggcgagccgctgactattcac
gcgggcctggacgacacctggatgcaggcgttatcacaatttggctggcgcggtctgctt
cctgaaaatgaaagggttgagttcagtgcgccatcgggtcaggatggagagataagttcc
taa
              
                            

Download fasta file
RegulonDB