RegulonDB RegulonDB 10.8: Gene Sequence
yqcC gene sequence


Size: 330        A: 78  T: 79  G: 86  C: 87

Fasta

 

>yqcC E. coli K12. Version NC_000913.3 GI:556503834
atgaccactcatgaccgcgttcgtctccagttgcaggcgcttgaagcgttactgcgtgaa
catcagcactggcgaaacgatgaaccccagccgcatcaatttaatagtacccaaccgttc
tttatggacaccatggaaccactggagtggttgcagtgggtgctgatcccgcgaatgcac
gatttgttagataacaaacagccgttaccgggcgcttttgccgttgcaccctattatgaa
atggcgctggcgacggaccatccgcaacgcgcgcttattctggctgagctggaaaaactg
gatgctctttttgcggatgatgcgagctaa
              
                            

Download fasta file
RegulonDB