RegulonDB RegulonDB 10.8: Gene Sequence
syd gene sequence


Size: 546        A: 150  T: 135  G: 134  C: 127

Fasta

 

>syd E. coli K12. Version NC_000913.3 GI:556503834
gtggacgatttgaccgcacaagccctgaaagattttactgcacgctactgcgatgcgtgg
catgaagagcataaaagctggccgttaagtgaggaactgtacggtgttccttcaccgtgc
attatttcaactaccgaagatgccgtatactggcaaccccagccgtttaccggggaacaa
aatgtaaacgcggttgaacgcgcttttgatattgtgatacaacccacaattcataccttt
tatacgactcagtttgccggggatatgcacgcgcagtttggcgatatcaaactgacattg
ctgcaaacctggagtgaagacgacttccgtcgggtgcaggaaaatctgattggtcatctg
gtgactcagaaaaggctaaaactgccgcccacactatttatcgcgacgctggaagaagag
ttagaggtcatctcggtgtgtaatctctccggtgaagtgtgcaaagagacgctgggaaca
cgtaaacggacgcatttagcctcaaatcttgcggaattccttaatcaacttaagcctctt
ctgtaa
              
                            

Download fasta file
RegulonDB