RegulonDB RegulonDB 10.8: Gene Sequence
queF gene sequence


Size: 849        A: 220  T: 214  G: 207  C: 208

Fasta

 

>queF E. coli K12. Version NC_000913.3 GI:556503834
atgtcttcttatgcaaaccatcaggcacttgcgggcctgactcttggaaaatcaaccgat
taccgggatacctatgacgccagcctactgcaaggcgttccacgcagcctgaatcgcgac
ccgctgggtctgaaagcggataacctgccttttcacggtacggatatctggacgctgtat
gaactttcctggctgaatgcgaaaggtttgccgcaggtcgctgtcggtcatgttgaactt
gattacaccagcgtaaatctgattgagtcgaagagttttaagctctatctcaacagtttt
aaccagacgcgttttaataactgggatgaggtgcgccagacgctggagcgcgacttaagc
acttgcgctcagggtaagattagcgtggcgttatatcgtcttgatgaactggaaggccag
ccgataggtcattttaatggcacttgcattgatgaccaggatatcactatcgataactat
gaattcactactgactatctggagaatgccacctgtggtgaaaaagtagtggaagagacg
cttgtcagccacctgctgaaatcaaactgcctgatcacccatcaaccagattggggttcg
ctccaaattcagtatcgtggacgccaaattgacagagaaaaactgctgcgttacctggtc
tcattccgtcatcacaacgagttccacgaacagtgcgtggaacgcatctttaatgacctg
ttacgcttctgccagccagaaaaattgagcgtttacgcacgttatacccgtcgtggcggt
ctggacattaacccgtggcgcagtaatagcgattttgtcccatcgaccacaagactggtt
cggcaataa
              
                            

Download fasta file
RegulonDB