RegulonDB RegulonDB 10.8: Gene Sequence
ygeG gene sequence


Size: 492        A: 187  T: 144  G: 86  C: 75

Fasta

 

>ygeG E. coli K12. Version NC_000913.3 GI:556503834
atgagcacagaaacaattgaaatattcaataatagtgatgaatgggcaaatcaactaaaa
cacgcattatcgaaaggagaaaatctggcattactacatggtttaactcctgatatcctt
gatagaatatatgcatatgcattcgactaccatgaaaagggtaatataacggacgcagaa
atttattataaattcttgtgcatttatgcgttcgaaaatcatgagtatctaaaagatttt
gcatcagtatgtcagcccaaaaagaaatatcaacaagcatatgacctttacaaactaagt
tacaattacttcccgtatgatgactattcagttatttatcgtatgggtcaatgtcagatt
ggggctaaaaatatcgataacgcaatgcaatgtttctatcacattattaacaattgtgag
gatgatagtgttaagagtaaagcgcaggcatatattgaactcttaaacgataattcagaa
gataatggctaa
              
                            

Download fasta file
RegulonDB