RegulonDB RegulonDB 11.0: Gene Sequence
glcA gene sequence


Size: 1683        A: 317  T: 466  G: 471  C: 429

Fasta

 

>glcA E. coli K12. Version NC_000913.3 GI:556503834
atggttacctggacccaaatgtatatgccgatgggaggactggggctatccgctctggtc
gccctgatcccgataatattcttcttcgttgcactcgcggtattacgtctgaaaggacat
gtcgctggagcaataacccttatattatctatcctgattgcaatattcgcctttaaaatg
ccgattgatatggcatttgctgctgcgggctatggctttatttatggattatggccaata
gcgtggattattgtcgcggcggtgttcctgtataaattaaccgttgccagcgggcagttc
gatattatccgcagctcggttatctccatcaccgacgatcagcgtttgcaggtgttactg
attggtttctcctttggtgcgttgctggaaggagcggctggctttggtgcgccggtggcg
attaccggtgcgctgctggtgggcctgggcttcaaaccgttatacgcggcggggctgtgt
ctgattgccaatactgcgccggtggcgtttggtgcgttgggcgtgccgattctggtcgcc
ggtcaggtaacgggaatcgatccgttccacattggcgcaatggcgggacgtcagttaccg
ttcctgtcggttcttgtgccgttctggctggtagcaatgatggacggctggaaaggggtg
aaagagacgtggccagcggcgctggttgctgggggaagcttcgctgtcactcagttcttt
acctctaactatattggtccggaactgccggatattacttcggcgctggtgagtatcgtc
tcactcgctttattccttaaagtctggcggccgaaaaataccgaaacggcaatcagcatg
ggacaatccgcaggtgcgatggtggtaaataagccatcttctggcggtcccgtgccttca
gaatatagtctggggcaaatcattcgagcgtggtcaccgtttttaatcttaacggtgctg
gtcaccatctggaccatgaagccgtttaaagcgttatttgctccgggcggcgcgttttat
tcactggtgattaatttccagatccctcatttgcatcaacaagtgttgaaagcggcaccc
attgtcgcccaaccaacgccaatggatgcggtgtttaaattcgaccccctctcggctggc
ggcaccgctatttttattgcggcgattatctctatcttcatcctcggtgtggggatcaag
aaaggtattggcgtctttgccgaaacgctaattagcttgaagtggccgatactgtcgatt
ggcatggtgctggcgttcgccttcgtcaccaactattctggcatgtccaccacgctggcg
ctggtactggcaggtacaggcgtgatgttcccgttcttctcaccgtttctcggctggctg
ggcgtattccttaccggctcggacacctcctctaacgccctgtttggttcactgcaatcg
accacggcgcagcaaatcaacgtctctgacaccctgctggtggcagcaaacaccagcggc
ggcgtaactggcaagatgatctccccgcaatctatcgccgtggcctgcgccgcgacgggc
atggtgggccgagaatctgaactgttccgctacaccgtgaagcacagtctgatttttgcc
agcgttatcggcattatcaccctgctgcaggcgtatgtgtttaccgggatgttagtctcg
taa
              
                            

Download fasta file
RegulonDB