RegulonDB RegulonDB 10.9: Gene Sequence
glcE gene sequence


Size: 1053        A: 217  T: 230  G: 323  C: 283

Fasta

 

>glcE E. coli K12. Version NC_000913.3 GI:556503834
atgctacgcgagtgtgattacagccaggcgctgctggagcaggtgaatcaggcgattagc
gataaaacgccgctggtgattcagggcagcaatagcaaagcctttttaggtcgccctgtc
accgggcaaacgctggatgttcgttgtcatcgcggcattgttaattacgacccgaccgag
ctggtgataaccgcgcgtgtcggaacgccgctggtgacaattgaagcggcgctggaaagc
gcggggcaaatgctcccctgtgagccgccgcattatggtgaagaagccacctggggcggg
atggtcgcctgcgggctggcggggccgcgtcgcccgtggagcggttcggtccgcgatttt
gtcctcggcacgcgcatcattaccggcgctggaaaacatctgcgttttggtggcgaagtg
atgaaaaacgttgccggatacgatctctcacggttaatggtcggaagctacggttgtctt
ggcgtgctcactgaaatctcaatgaaagtgttaccgcgaccgcgcgcctccctgagcctg
cgtcgggaaatcagcctgcaagaagccatgagtgaaatcgccgagtggcaactccagcca
ttacccattagtggcttatgttacttcgacaatgcgttgtggatccgccttgagggcggc
gaaggatcggtaaaagcagcgcgtgaactgctgggtggcgaagaggttgccggtcagttc
tggcagcaattgcgtgaacaacaactgccgttcttctcgttaccaggtaccttatggcgc
atttcattacccagtgatgcgccgatgatggatttacccggcgagcaactgatcgactgg
ggcggggcgttacgctggctgaaatcgacagccgaggacaatcaaatccatcgcatcgcc
cgcaacgctggcggtcatgcgacccgctttagtgccggagatggtggctttgccccgcta
tcggctcctttattccgctatcaccagcagcttaaacagcagctcgacccttgcggcgtg
tttaaccccggtcgcatgtacgcggaactttga
              
                            

Download fasta file
RegulonDB