RegulonDB RegulonDB 10.10: Gene Sequence
glcC gene sequence


Size: 765        A: 175  T: 169  G: 219  C: 202

Fasta

 

>glcC E. coli K12. Version NC_000913.3 GI:556503834
atgaaagatgaacgtcgccctatttgcgaagtggttgcagagagtatcgaacggttaatt
atcgacggcgtactgaaggtcggtcagccgcttccctcggaacgtcgactgtgtgaaaag
ctcggcttctcacgctccgcactgcgtgaagggctgaccgtgctgcgcgggcgcgggatt
attgaaacggcgcagggtcgcgattctcgtgtcgcacggcttaatcgggtgcaggacacc
agcccgctgatccatctgttcagtacgcagccgcgaacgctgtacgatctgctcgacgtt
cgcgcattactggagggcgaatcggcaaggctggcggcaacgctgggaacgcaggctgat
tttgttgtgataacccgctgttatgaaaaaatgctcgccgccagtgagaacaacaaagag
atttcgctgatcgaacatgcgcagttggatcacgctttccatctcgccatttgtcaggct
tctcacaatcaggtgctggtgtttacgctgcaatcattgaccgatctgatgtttaattca
gtgtttgccagcgtaaataatctctaccatcgaccacagcaaaaaaagcagatcgatcgc
cagcatgcgcggatctacaacgcggtgttgcagcggctgccgcacgtcgcccagcgcgca
gcacgcgatcatgtgcggaccgtgaaaaagaatctccacgatatcgagctggaaggccac
catttgattcgctcggcggtgccgctggagatgaacctgagttag
              
                            

Download fasta file
RegulonDB