RegulonDB RegulonDB 10.9: Gene Sequence
yqhD gene sequence


Size: 1164        A: 285  T: 243  G: 317  C: 319

Fasta

 

>yqhD E. coli K12. Version NC_000913.3 GI:556503834
atgaacaactttaatctgcacaccccaacccgcattctgtttggtaaaggcgcaatcgct
ggtttacgcgaacaaattcctcacgatgctcgcgtattgattacctacggcggcggcagc
gtgaaaaaaaccggcgttctcgatcaagttctggatgccctgaaaggcatggacgtgctg
gaatttggcggtattgagccaaacccggcttatgaaacgctgatgaacgccgtgaaactg
gttcgcgaacagaaagtgactttcctgctggcggttggcggcggttctgtactggacggc
accaaatttatcgccgcagcggctaactatccggaaaatatcgatccgtggcacattctg
caaacgggcggtaaagagattaaaagcgccatcccgatgggctgtgtgctgacgctgcca
gcaaccggttcagaatccaacgcaggcgcggtgatctcccgtaaaaccacaggcgacaag
caggcgttccattctgcccatgttcagccggtatttgccgtgctcgatccggtttatacc
tacaccctgccgccgcgtcaggtggctaacggcgtagtggacgcctttgtacacaccgtg
gaacagtatgttaccaaaccggttgatgccaaaattcaggaccgtttcgcagaaggcatt
ttgctgacgctaatcgaagatggtccgaaagccctgaaagagccagaaaactacgatgtg
cgcgccaacgtcatgtgggcggcgactcaggcgctgaacggtttgattggcgctggcgta
ccgcaggactgggcaacgcatatgctgggccacgaactgactgcgatgcacggtctggat
cacgcgcaaacactggctatcgtcctgcctgcactgtggaatgaaaaacgcgataccaag
cgcgctaagctgctgcaatatgctgaacgcgtctggaacatcactgaaggttccgatgat
gagcgtattgacgccgcgattgccgcaacccgcaatttctttgagcaattaggcgtgccg
acccacctctccgactacggtctggacggcagctccatcccggctttgctgaaaaaactg
gaagagcacggcatgacccaactgggcgaaaatcatgacattacgttggatgtcagccgc
cgtatatacgaagccgcccgctaa
              
                            

Download fasta file
RegulonDB