RegulonDB RegulonDB 11.1: Gene Sequence
ygiW gene sequence


Size: 393        A: 113  T: 76  G: 111  C: 93

Fasta

 

>ygiW E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattcgcagcagtaatcgcagtaatggccctgtgcagcgcaccggtgatggca
gcagagcagggcggtttttctggcccatcggcaacgcaaagtcaggccggaggattccag
gggccgaacggcagcgtaacgactgtagaaagcgcaaaatccctgcgtgacgacacctgg
gtaaccctgcgcggcaatatcgttgaacgcatctctgacgatctctacgtgttcaaagat
gccagcggtactatcaatgttgatatcgaccacaaacgctggaacggcgtgacggtgacg
ccgaaagatacggttgagattcagggtgaagtcgataaagactggaattctgttgaaatt
gacgtcaaacagatccgcaaagtaaatccgtaa
              
                            

Download fasta file
RegulonDB