RegulonDB RegulonDB 11.0: Gene Sequence
nfeF gene sequence


Size: 765        A: 163  T: 171  G: 225  C: 206

Fasta

 

>nfeF E. coli K12. Version NC_000913.3 GI:556503834
atgaataacaccccccgctacccgcagcgcgttcgcaatgatctgcgcttccgtgaactg
actgtgttacgcgttgagcgcatcagcgccggttttcagcgcattgtcctcggcggcgag
gcgctggacggttttacatcgcgtggctttgacgatcacagcaaactcttctttcctcaa
cctgacgctcactttgtgccgccaacggtaacggaagagggcatcgtctggccggaagga
ccacgcccaccgtcgcgtgactatacgccgctgtatgacgaactacgccatgaactggcg
attgatttctttattcacgacggtggggtcgccagcggctgggcgatgcaggcgcaaccg
ggcgataaacttacggtggcaggtccgcgcggttcgctggtggtgccggaagattacgcg
tatcagctgtatgtctgcgatgaatccggaatgcctgcattgcgccgccgcctggaaacg
ttgagcaaacttgccgttaaaccgcaagttagtgcgctggttagcgtgcgggataacgcc
tgtcaggattatctcgcgcaccttgatggttttaatatcgaatggctggcacatgatgag
caggcggtagatgcgcgtctggcgcagatgcaaatccctgccgatgattacttcatctgg
ataaccggcgaaggtaaagtcgttaagaatttaagccgccgctttgaagcggaacagtat
gacccacagcgggtacgtgcagcggcttactggcacgcaaagtaa
              
                            

Download fasta file
RegulonDB