RegulonDB RegulonDB 10.10: Gene Sequence
mzrA gene sequence


Size: 384        A: 87  T: 90  G: 91  C: 116

Fasta

 

>mzrA E. coli K12. Version NC_000913.3 GI:556503834
atgcaaatacctcgcatgtcgcttcgccagctagcctggtccggcgctgttttacttctg
gtcggcacgctgttgctggcctggtccgcggttcgccagcaagagtctacgctggcgatt
cgtgccgttcatcaaggcacaacgatgccagacggtttttcaatctggcatcaccttgac
gctcatggcattcctttcaaaagtatcacccccaaaaacgacactctgttaattacattt
gactccagcgaccagagcgccgccgcaaaagcggtcctcgacagaacattgccccatggc
tacatcattgcgcagcaggacaataacagtcaggctatgcagtggctgacccggttacgg
gataactctcatcgcttcggataa
              
                            

Download fasta file
RegulonDB