RegulonDB RegulonDB 10.8: Gene Sequence
yqjF gene sequence


Size: 393        A: 87  T: 114  G: 104  C: 88

Fasta

 

>yqjF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattagaagatgttggtgtactggtagcgcgcattttaatgccgattctgttt
attaccgctggctggggaaaaattactggctacgcgggtacccaacaatatatggaagca
atgggcgtcccgggttttatgctgccactggtgattctgcttgagtttggtggtggtctg
gcaatcctgttcggtttcctgactcgcaccacagccctgtttactgcgggctttacgctg
ctgacggcatttttatttcacagcaactttgctgaaggcgtcaactcgctgatgttcatg
aaaaacctgacaatttctggcggattcctgctgctggcaattaccggtccgggcgcgtat
agcatcgaccgcctgctgaataaaaagtggtaa
              
                            

Download fasta file
RegulonDB