RegulonDB RegulonDB 11.0: Gene Sequence
agaD gene sequence


Size: 792        A: 182  T: 219  G: 206  C: 185

Fasta

 

>agaD E. coli K12. Version NC_000913.3 GI:556503834
atgggatctgaaatcagtaaaaaagatatcacccgtctgggctttcgttcgtcgctgctg
caagcgagctttaactacgaaaggatgcaggcgggcggttttacctgggcgatgttgccg
atcctgaaaaagatttataaggacgacaaaccgggcttaagcgcggcgatgaaagataac
ctcgaatttattaatacccacccgaatctggtcggattcctgatggggttattaatttcg
atggaagaaaaaggagaaaaccgcgacaccattaaaggcctcaaagtggcactgtttggc
ccaatcgccgggattggcgatgcgattttctggtttactttgttgccgattatggcggga
atttgctcatcatttgccagccagggaaacctgctggggccgattctatttttcgccgtt
tacctgcttatctttttcctgcgcgtcggctggacccacgtcggttattcagtcggcgtg
aaggcgatcgataaagtgcgagagaactcgcagatgattgcccgttcggcaaccatcctc
gggatcacggtaatcggcgggctgatcgcttcgtatgtgcatattaacgtggtgacatcg
tttgccatcgacaatacccacagcgttgcgctgcagcaggatttcttcgataaagtcttc
ccgaacattttaccgatggcctacaccctgctgatgtattacttcctgcgggtgaaaaaa
gcgcatccggtgctgttaatcggcgtgacttttgtgctctctattgtttgttccgcattc
ggcattttgtaa
              
                            

Download fasta file
RegulonDB