RegulonDB RegulonDB 11.0: Gene Sequence
yhbS gene sequence


Size: 504        A: 100  T: 124  G: 164  C: 116

Fasta

 

>yhbS E. coli K12. Version NC_000913.3 GI:556503834
atgctaattcgagtagaaattcccattgatgcgccgggtattgatgccctgctgcgtcgc
tcattcgaaagtgatgcggaagcgaagctggttcacgatctgcgtgaagatggctttctg
acgctggggctggtggcgacagatgacgaaggtcaggtcattggctatgtggcatttagt
ccggttgatgtgcagggcgaagacctgcaatgggtcggcatggcaccgttggcggttgat
gaaaaataccgtggacaggggctggcacgccaactggtctatgaaggactcgattcgctt
aatgagttcggctatgccgcagtggtgacgctgggcgatccggcgctgtacagtcgtttc
ggctttgaactggcggcgcatcacgatctgcgttgccgctggccgggcactgaaagcgcc
ttccaggtacatcgtttagcggatgacgcgctgaatggcgttaccggcctggttgagtat
cacgagcatttcaatcgcttttaa
              
                            

Download fasta file
RegulonDB