RegulonDB RegulonDB 11.0: Gene Sequence
b3254 gene sequence


Size: 102        A: 23  T: 32  G: 24  C: 23

Fasta

 

>b3254 E. coli K12. Version NC_000913.3 GI:556503834
gtggtcagtcgaaatcatgactttccagtttggatgatgttgtataacttcctgaccaag
gtgttcgacgaaagctgtccggctaaccgcttttcccgttaa
              
                            

Download fasta file
RegulonDB