RegulonDB RegulonDB 10.10: Gene Sequence
gspD gene sequence


Size: 1953        A: 519  T: 454  G: 492  C: 488

Fasta

 

>gspD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaggactcaataaaatcacctgctgcttgctggcagcactactcatgccttgtgca
ggacacgctgagaacgaacaatacggcgcgaacttcaataacgccgatatccgccagttc
gtggaaatagtgggtcagcatcttggcaaaacgatcctgatcgacccttcggtacaggga
accatttccgtacgcagtaatgatacgtttagccaacaggagtactaccagttcttttta
agtattcttgatctttacggttattccgtgatcacgctggacaatggttttctgaaagtg
gttcgctcagctaatgtaaaaacatcgccagggatgattgctgacagttctcgtccaggc
gtaggtgatgagttggtcacccgaattgtaccgcttgagaacgttcctgctcgtgacctg
gcccccctgctccgccagatgatggatgcgggtagcgtcggtaatgttgtgcattatgaa
ccctccaacgttcttattctgaccggtcgtgcctccaccattaataaactgattgaagtc
ataaagcgcgttgatgtcatcggcacagagaagcagcaaattattcatctggaatatgcg
tcagcggaagatctcgccgagattcttaatcaattaatcagcgaaagccacggtaaaagc
cagatgccagccctcctctccgcgaagattgtggcggataagcgaaccaactctcttatc
atcagtggaccggaaaaagcacgccagcgcatcacttcattactgaaaagccttgatgtc
gaagagagcgaggaaggaaatacccgggtttattacctgaaatatgctaaagccacgaat
ctggtggaagtgctaaccggtgtttccgaaaagctgaaagatgaaaaagggaatgcgcgt
aagccctcctcttctggcgcgatggataacgtcgccattaccgccgatgaacagactaac
tctctggtcattaccgctgaccagtccgtccaggaaaaactcgccacggtaattgcgcgt
ctggacattcgccgtgcacaggtgctggttgaggcaatcatcgttgaagttcaggatgga
aatggactaaacctcggcgtgcaatgggcgaataaaaacgttggcgcacagcaatttacc
aataccggattaccgatttttaacgctgcgcaaggtgtggctgattataaaaagaatggt
gggatcaccagcgcgaatcctgcctgggatatgtttagcgcctacaatggcatggccgca
ggcttcttcaatggcgactggggagtactgcttaccgcgctggccagtaacaataaaaat
gacatcctcgccaccccaagcatcgtaacgctggataataaactcgcgtccttcaacgtg
gggcaggatgtgccggtgctatccgggtcacagaccacttcaggggataacgtctttaat
accgtcgaacgcaaaacggtggggacaaaactcaaagttactccgcaggtcaatgaaggc
gacgcggtgttgctcgaaatagagcaggaagtctccagcgttgactcttcctctaactcg
acgctcggcccgacgtttaatacccgtactattcaaaacgccgtgctggtcaaaaccggt
gaaacggtggtcctgggcggattgctggatgatttttctaaagagcaagtgtcaaaggtt
cctctgcttggcgatattcctttagtggggcaactcttccgctatacctccaccgagcgc
gctaaacgcaacctgatggtatttatccgtccgacgattatccgtgacgatgatgtttat
cgctcactgtcaaaagagaaatacacccgttaccgtcaggagcaacaacagcggatcgac
gggaaatcaaaagcgctggttggctcggaagatttgccggtgctggatgaaaacacgttc
aacagtcacgcccctgcgccatcgtcacggtga
              
                            

Download fasta file
RegulonDB