RegulonDB RegulonDB 10.10: Gene Sequence
gspE gene sequence


Size: 1482        A: 371  T: 333  G: 378  C: 400

Fasta

 

>gspE E. coli K12. Version NC_000913.3 GI:556503834
atgagaattcactcaccgtaccccgccagttgggcgctggcacaacgaattggttatctc
tattcagagggcgagattatttatctcgccgatacgccattcgagcggttactcgatatt
caacgtcaggttggccagtgccagaccatgaccagcttgtcacaggctgattttgaagct
cggctggaagcggtattccatcagaataccggtgagtcgcaacagattgcgcaggatatc
gatcaatccgtcgatcttctctcgctttcggaagagatgcccgcaaatgaagatctcctg
aatgaagattcagcggcaccggttatccgcttgatcaatgcgattttgagtgaggccatc
aaagaaaccgcctctgatatccacattgaaacctatgaaaaaacaatgtcgatccgtttt
cgcatcgacggcgttttgcggacaattttacagccaaacaaaaaactggcggcactgctt
atctcccgaattaaggtcatggctcgtcttgatatcgccgaaaaacgtattccacaggat
ggaagaattagtttgcgtatcgggcgacgtaacatagatgtccgcgtatccacactgccg
tccatctatggtgaacgcgccgtactccgcctgctggataaaaacagcctccagctttca
ttgaacaacctggggatgacggcagcggataagcaggatttagaaaatctcattcagctt
ccgcacggtattatcctggtgacagggccgacaggctccggtaaaagcaccacgctctac
gccatcctttcggcgctgaatactcccggccgcaatattctgacggtagaagatcccgtg
gaatatgagctggaaggcattgggcaaacgcaggtgaatacccgtgtggatatgtctttc
gctcgcggcctgcgcgccatacttcgccaggacccggatgtcgtcatggtgggggaaatt
cgtgatacagaaaccgcgcagattgcggttcaggcctcgctcaccggccatctggtactc
tcaacactccacactaacagtgcatcaggcgcagtgacccggctccgcgacatgggcgtc
gaatcattcctgctttcgtcttccctggcagggattatcgcgcaacgtctggttcgtcgc
ctgtgtccgcaatgccgacaattcacgcccgtatcaccccaacaagcgcagatgtttaaa
tatcatcagctcgcggtgacaacaattggcactcccgtaggctgccctcattgccatcaa
tccggctatcaggggcgcatggcgatccacgaaatgatggtggtgacgccggaattacgg
gccgctattcatgaaaatgtggatgaacaagcactggagcgactagtccggcaacaacac
aaggccttaatcaaaaatggcctgcaaaaagtgataagcggtgacacctcctgggatgag
gttatgcgcgtcgccagtgccacgctggagagcgaagcatga
              
                            

Download fasta file
RegulonDB