RegulonDB RegulonDB 10.10: Gene Sequence
yhgH gene sequence


Size: 684        A: 134  T: 167  G: 184  C: 199

Fasta

 

>yhgH E. coli K12. Version NC_000913.3 GI:556503834
atgctaacagtaccgggattatgctggctatgccgaatgccactggcgttaggtcattgg
gggatttgttcggtctgttcacgcgccacccgcacagataaaacgttatgcccacaatgt
ggattacccgccacacactcccatcttccctgcggtcgctgcctgcaaaaaccgccgccc
tggcaaagactggtcacggttgccgactatgcgccgccgttaagtccgcttatccaccag
cttaaattttcccggcgcagtgaaatcgccagcgccctgtcacgtctgttactattggaa
gtcttacacgctcgtcgcaccaccgggttgcaattgccggatcgcatcgtcagcgttccg
ttatggcagcggcgtcactggcgtcggggatttaatcagagcgatttgctgtgtcagccg
ttatcacgctggttgcactgccaatgggatagcgaagccgtcacacgtacacgggccact
gcgacccagcattttctcagtgcccggctgcgcaagcgcaacctgaaaaatgcctttcgt
cttgaattgcccgtgcaaggtcgccatatggtgattgtggatgatgtcgttaccaccgga
agtaccgtcgcagagattgcgcagttgcttttacgcaatggtgcggcggctgtccaggtc
tggtgcctttgtcgaaccttgtag
              
                            

Download fasta file
RegulonDB