RegulonDB RegulonDB 10.10: Gene Sequence
nfuA gene sequence


Size: 576        A: 144  T: 125  G: 159  C: 148

Fasta

 

>nfuA E. coli K12. Version NC_000913.3 GI:556503834
atgatccgtatttccgatgctgcacaagcgcactttgccaaactgctggcaaatcaggaa
gaagggacacaaatccgcgtatttgtgattaaccctggcacgcctaacgctgaatgtggc
gtttcttattgtccgccggacgctgtggaagccaccgacacagccctgaaatttgacctg
ctgaccgcgtatgttgatgagttaagcgcaccatacctggaagatgcagagatcgatttt
gttaccgaccagttgggttcccagttaacgctgaaagccccgaacgccaaaatgcgtaaa
gtggcagacgatgcaccgctgatggagcgcgtggagtatatgctgcagtcgcagatcaac
ccacagcttgctggtcacggtggtcgcgtttcgctgatggaaatcaccgaagacggttac
gccattctgcaatttggcggcggctgtaacggttgttccatggtcgatgtgacgctgaaa
gaagggatcgagaagcagctgctgaacgaattcccggagctgaaaggtgtgcgcgatctc
accgaacaccagcgcggcgaacactcctactactaa
              
                            

Download fasta file
RegulonDB