RegulonDB RegulonDB 10.9: Gene Sequence
rtcA gene sequence


Size: 1017        A: 196  T: 214  G: 346  C: 261

Fasta

 

>rtcA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaggatgattgcgctggatggcgcacagggcgaaggtggcgggcagatcctgcgc
tcggcgctgagcctgtcgatgataaccggccagccatttaccatcaccagcattcgtgcc
gggcgggcgaaaccggggctgttgcgccagcatctgaccgcggtaaaggcggcgacggaa
atttgcggagcaaccgtggaaggcgcggagctggggtcgcagcgtctgctcttccggccc
ggcaccgtgcgcggcggcgattaccgctttgctatcggtagcgccggaagttgtacgctg
gtgctgcaaacggtgctgcccgcgctgtggtttgccgatggaccttcgcgtgttgaagtg
agcggcggcaccgataacccgtcggcgccgcctgcggattttatccgccgggtgctggag
ccgctgctggcgaaaataggaattcatcagcaaaccacgctgttacgccacggtttttac
cctgccggaggcggtgtggtggcaacggaagtctcgcccgtggcatcgtttaacaccttg
caacttggcgagcgcgggaacattgtgcagatgcgtggagaagttctattagctggtgtg
ccgcgccatgttgctgagcgtgaaatcgctacactggcggggagtttttccctgcatgaa
cagaatattcataacctgccgcgcgaccaggggccgggtaataccgtctcgcttgaagtc
gaaagtgaaaatatcaccgaacgcttttttgtcgtcggtgaaaagcgcgtcagtgccgag
gtggttgcggcacagttggtgaaagaggtgaaacgctacctggcaagcacggcggcggtg
ggggaatatcttgctgaccaactggtgctaccgatggcgctggcgggcgcgggggaattt
acggtcgcccatccctcatgccatctgctgaccaatatcgcggtggtggagcgtttcttg
ccggtgcggtttagtttgatagaaacagatggcgtaacgcgggtgagcattgaatga
              
                            

Download fasta file
RegulonDB