RegulonDB RegulonDB 10.9: Gene Sequence
rtcB gene sequence


Size: 1227        A: 330  T: 272  G: 356  C: 269

Fasta

 

>rtcB E. coli K12. Version NC_000913.3 GI:556503834
atgaattacgaattactgaccactgaaaatgccccggtaaaaatgtggaccaaaggcgtg
ccggtagaggccgatgcgcgtcagcaacttattaatacggcgaagatgccgtttattttc
aaacatattgcggtaatgcctgatgtacacctgggtaaaggttccaccattggtagcgtg
atcccgaccaaaggggcgattattccggcggcggtgggcgtggatattggctgtggaatg
aacgcgctgcgtaccgcgttaacggcggaagacctgcctgaaaacctggcagagctgcgt
caggcgattgaaacggccgtgccgcacgggcgtaccactggccgttgtaaacgtgataaa
ggtgcctgggaaaatccacctgttaacgtcgatgctaaatgggctgagcttgaagccggt
tatcagtggttaacgcaaaaatatccccgtttcctgaataccaataactataaacacctg
ggaacgctgggaaccggtaaccactttattgaaatctgccttgatgagtcggaccaggtg
tggattatgctgcactccggttcacgcggaattggtaacgccatcgggacttactttatc
gatctggcacaaaaagagatgcaggaaacgcttgagacgttgccgtcgcgtgatctggcg
tactttatggaaggtacggaatactttgatgattacctgaaagccgtggcctgggcgcag
ctttttgccagccttaaccgcgatgcgatgatggaaaacgtggtaacggcattgcagagc
attacgcagaaaacggtcagacagccacaaacgctggcgatggaagagatcaactgtcac
cacaactatgtgcaaaaagaacagcactttggtgaagagatctacgtgacgcgtaaaggc
gcggtgtctgcgcgtgctggtcaatatggaattattcccggttcgatgggagcaaaaagc
tttatcgtccgtgggctgggaaatgaagagtcgttctgttcgtgcagccacggtgccggg
cgggtaatgagccgaactaaagcgaaaaaactgttcagcgtggaagatcaaattcgtgcc
accgcgcatgtggaatgccgtaaagatgccgaagtgatcgacgaaatcccgatggcgtat
aaagatattgatgcggtgatggcggcacaaagcgatctggtggaagttatctataccctg
cgtcaggtggtgtgcgtaaaaggataa
              
                            

Download fasta file
RegulonDB