RegulonDB RegulonDB 11.1: Gene Sequence
yjdF gene sequence


Size: 630        A: 127  T: 157  G: 180  C: 166

Fasta

 

>yjdF E. coli K12. Version NC_000913.3 GI:556503834
atgacccgcacactcaagccgttaattcttaacaccagcgcactgacgctaacgttaatc
ctgatttataccggcatttcggcccatgacaaactcacctggctgatggaagtgacaccg
gtgattattgtcgtgcagctactgcttgccaccgccagacgttatccgttaacgccgctg
ctctatacgctcattttccttcacgccatcatcctgatggtcggcggacaatacacctac
gcgaaagtccccgttggttttgaggtgcaggaatggctggggttgagtcgtaatccgtat
gacaagctggggcactttttccaggggctggtgcctgcactggtggcacgagaaattctc
gttcgcgggatgtacgtgcgcggacgtaaaatggtggcgttcctggtctgctgcgtggcg
ctggcgataagcgcgatgtatgaattaatcgagtggtgggcagcgctggcaatgggtcag
ggagcggatgattttctcggcacccagggcgaccagtgggacacgcaatccgatatgttc
tgcgcgctgcttggcgcattaacgacggtgatattcctcgctcgctttcattgccgccag
ctacggcgctttggcttgataaccggataa
              
                            

Download fasta file
RegulonDB