RegulonDB RegulonDB 10.10: Gene Sequence
mscM gene sequence


Size: 3324        A: 716  T: 755  G: 958  C: 895

Fasta

 

>mscM E. coli K12. Version NC_000913.3 GI:556503834
gtgcgcctgattatcacttttctgatggcctggtgcctcagttggggggcgtacgccgcg
acggcccccgatagcaaacaaatcactcaggaactggagcaggcaaaagcggcgaaaccc
gcacagccggaagtcgtagaggcgctccagtctgccttaaatgcgcttgaggaacgaaaa
ggttcccttgagcgcatcaaacaatatcagcaagttatcgataattatccgaaactctcc
gctactctgcgcgcacaattaaacaacatgcgtgacgagccgcgcagcgtgtcgccggga
atgtctaccgacgcgctgaatcaggaaattctccaggtcagcagccagttgctggataaa
agccgtcaggcccagcaagagcaggagcgcgcccgcgagattgccgattcgctgaatcaa
ctgccgcaacagcaaaccgacgcccgccgtcagttaaatgagatcgagcgccgcctggga
acgcttaccggcaatactccgctcaatcaggcacaaaatttcgcgttgcagtctgactct
gcacgtcttaaggcgctcgttgatgaactggagctggcgcagctgtctgccaataaccgc
caggaattagcgcgcttacgctcagagctggcggaaaaagagagccagcaactggatgcg
tatttgcaggccttgcgtaatcaattaaacagccaacgtcagcttgaggcggagcgggcg
ctggaaagtaccgaattgctggcagaaaacagcgccgatttgccgaaagatatcgtcgcg
caattcaaaattaaccgcgaactatcggcggctttgaatcaacaggcgcagcggatggat
ctcgttgcctcgcaacagcgtcaggctgccagccagacgttacaggtccggcaggcgttg
aatacgctgcgtgaacagtcgcaatggctgggatcgtccaatctgctcggcgaagcgctg
cgggcgcaggtggcacggctgccggaaatgccgaaaccacaacagcttgataccgaaatg
gcgcagttgcgtgtgcaacggttacgttatgaggatctgcttaataaacagccgctgcta
cggcaaattcatcaggccgacggtcagccgctgactgccgagcaaaaccgtattctggaa
gcacaactgcgcactcagcgtgagttgctgaactcattgttgcagggtggcgacacgcta
ctattggaactgaccaagctgaaagtctccaacgggcaactggaggatgcgctgaaagag
gtgaacgaagcaacgcaccgctatctgttctggacctctgacgtgcgcccgatgaccatc
gcctggccgctggaaatcgcccaggatctgcgtcgtctcatttcgctggacaccttcagt
cagttgggcaaagccagtgtgatgatgctgaccagcaaagagacaattttgccgctgttt
ggcgcgttgattctggtcggttgcagtatttactcgcgccgctatttcacccgttttctt
gaacgttcggcggcgaaagttggcaaagtgactcaggatcacttctggctgacgttgcgc
actcttttctggtcgattctcgtcgcgtcaccgttaccggtgctgtggatgacgctgggt
tacggcttgcgcgaggcgtggccttatccgctggcggtcgcgattggcgatggtgtaacg
gccaccgtgccgctgctgtgggtagtgatgatttgcgccacctttgcccgcccgaacggc
ttgtttatcgctcattttggctggccgcgcgaacgtgtttcccgtgggatgcgctactac
ctgatgagcatcgggcttattgtgccgctgattatggcgctgatgatgttcgataacctc
gacgaccgtgaattctccggttcgctgggacggctttgctttatcctcatttgcggtgcg
ctggcggtggtcaccctcagcctgaaaaaggccgggattccgctgtatctcaacaaagag
ggcagcggcgacaacattaccaaccatatgctgtggaacatgatgattggcgcgccgttg
gttgccattctggcgtcggcggtgggttatctggcaacggcacaggcgctgttagcgagg
cttgaaacctcggttgccatctggttcctgctactggtggtttatcacgttatccgccgc
tggatgctgatccagcgccgcaggctggcgtttgatcgggcgaagcatcgccgggcagag
atgttagcgcaacgtgcgcgtggcgaagaggaagcgcatcatcacagtagcccggaagga
gcaattgaagtcgatgaaagcgaagtcgatctcgatgccatcagtgcgcaatccttgcgg
ctggtgcgctcaattttgatgttgatcgccctgctttctgtcattgtgctgtggtcagaa
atccattccgctttcggcttcctcgaaaatatttcgctgtgggatgtcacctccacggta
cagggcgtagaaagtctggagccaattaccctcggtgcggtgctgattgccattctggtg
tttatcatcaccacgcagctggtgcgcaacttgcccgcgctgctggaactggcgattttg
cagcacctggatttaacgccgggtacgggttacgccatcaccaccatcaccaaatatctg
ctgatgctgattggcgggctggtcggcttctcaatgattggtattgagtggtcgaaattg
cagtggctggttgccgcgctcggtgttggtctcggttttggtttgcaggaaattttcgcc
aactttatctctggtctgattatcctgttcgaaaaaccgattcgcattggcgatacggtg
acaattcgcgatctcaccggtagcgtgacgaaaattaacacccgcgccaccaccatcagc
gactgggaccgtaaagagataatcgtgccgaacaaggcgtttattaccgagcagtttatc
aactggtcgctctctgactcggtcacgcgcgtggtgttgacgataccggcccctgccgat
gccaatagcgaagaagtgacggaaatcctgctcaccgcagcgcgtcgctgctcgctggtg
atcgacaacccggcaccggaagtcttcctggtggatctgcaacaggggattcagattttc
gagctgcgtatttacgccgctgagatgggtcaccgtatgccgctacgccatgagatccac
cagctgattctggctggcttccatgcccacggtatcgatatgccattcccgcccttccag
atgcgtctggaaagcctcaacggtaaacaaacggggagaacgctgacgtctgcgggcaaa
ggtcgtcaggcgggaagtttgtaa
              
                            

Download fasta file
RegulonDB