RegulonDB RegulonDB 10.9: Gene Sequence
ulaR gene sequence


Size: 756        A: 220  T: 153  G: 205  C: 178

Fasta

 

>ulaR E. coli K12. Version NC_000913.3 GI:556503834
atgactgaagcacaaagacatcaaatcctcctggaaatgctcgcacaattgggctttgtg
accgttgagaaagtcgttgagcgtctgggaatttcgcctgccactgcgcgacgcgatatc
aataaacttgacgaaagcggcaaactgaaaaaagtgcgcaatggcgcagaagctattacc
caacagcgcccgcgctggacgccgatgaatctgcatcaggcgcagaatcacgatgaaaaa
gtacgtatcgctaaagcggcctcgcagctggttaatccgggcgaaagcgtagtcatcaac
tgcggctccaccgcgtttctgcttgggcgggaaatgtgtggcaagccagtgcaaatcatc
actaattatctaccgctggcaaattacctgatcgatcaagaacatgacagcgtgatcatt
atgggcggacagtacaacaaaagtcagtccatcactttaagcccgcagggcagcgaaaac
agtctctatgccgggcactggatgtttaccagcggaaaagggctgaccgcagaagggttg
tataaaaccgatatgctgacagcaatggcagagcagaagatgctgagcgtggtagggaaa
ctggtggtactggttgatagcagtaagattggcgaacgcgcgggaatgctttttagccgt
gccgatcaaatcgatatgcttatcaccggcaaaaatgctaacccggaaatcctgcaacaa
ctggaagcgcaaggggtcagcattctgcgtgtttaa
              
                            

Download fasta file
RegulonDB