RegulonDB RegulonDB 10.9: Gene Sequence
ulaG gene sequence


Size: 1065        A: 267  T: 242  G: 294  C: 262

Fasta

 

>ulaG E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaagtgaaaagtatcacccgtgaatcctggatcctgagcactttcccggagtgg
ggtagctggttgaatgaagaaattgaacaagaacaggtcgctcctggcacatttgcgatg
tggtggcttggctgcaccgggatctggttgaaatcggaaggtggcaccaacgtttgcgtt
gatttctggtgcggcactggcaaacaaagtcacggtaacccgttaatgaaacagggtcac
cagatgcagcgcatggctggcgtgaaaaaactgcagccaaacctgcgtaccaccccgttt
gttcttgatccgtttgcgattcgccagatcgacgcggtactggcgactcacgatcacaac
gatcatatcgacgttaacgtcgctgctgccgtgatgcagaattgtgcagatgacgtaccg
tttatcggaccgaaaacctgtgtggatttgtggattggctggggcgtaccgaaagagcgt
tgcatcgtggtcaaaccgggcgatgtagtaaaagtgaaagacattgaaattcatgcgctt
gatgctttcgaccgtactgcactgatcaccctgcctgccgatcaaaaagcggctggcgta
ctgccagatggcatggacgatcgcgcggtgaactacctgttcaaaacgcctggcggctcc
ctgtatcacagcggcgactcccactactctaactattatgcgaagcacggtaacgaacat
cagatcgacgtggcgttaggatcgtacggcgaaaacccgcgcggtatcaccgacaaaatg
accagcgccgatatgctgcgtatgggtgaagcgctgaatgcgaaagtagtgatcccgttc
caccacgatatctggtcaaacttccaggccgatccgcaagagatccgcgtgctgtgggag
atgaaaaaagatcgcctgaagtatggcttcaagccgtttatctggcaggtgggtggcaaa
tttacctggccgctggataaagacaacttcgagtaccactatccgcgcggtttcgatgat
tgcttcactattgaaccggatctgccgttcaagtcattcctgtaa
              
                            

Download fasta file
RegulonDB