RegulonDB RegulonDB 10.9: Gene Sequence
yjhV gene sequence


Size: 330        A: 74  T: 78  G: 87  C: 91

Fasta

 

>yjhV E. coli K12. Version NC_000913.3 GI:556503834
ctacctgaagggagccgcggtcgcctggcagttgcagtagcaggagatcatccagccgca
gtacaggtcacgatgactctggttaatgataccggctttgaccccgtattttccggctct
atcgctgaatcatggcgtcagcagccgtgcacaccatcctattgttgtgactgggaggct
gccaccatgcttcgcgctttccctctggcgaaaaagggagaaggacgggcccgtctgcct
tcactttatgccagcttcggtaagctgggtgagacaccgactcatgaagatatcattgat
aacaatcgatccatcaactggcctgtataa
              
                            

Download fasta file
RegulonDB