RegulonDB RegulonDB 10.9: Gene Sequence
yjhG gene sequence


Size: 1968        A: 465  T: 430  G: 552  C: 521

Fasta

 

>yjhG E. coli K12. Version NC_000913.3 GI:556503834
atgtctgttcgcaatatttttgctgacgagagccacgatatttacaccgtcagaacgcac
gccgatggcccggacggcgaactcccattaaccgcagagatgcttatcaaccgcccgagc
ggggatctgttcggtatgaccatgaatgccggaatgggttggtctccggacgagctggat
cgggacggtattttactgctcagtacactcggtggcttacgcggcgcagacggtaaaccc
gtggcgctggcgttgcaccaggggcattacgaactggacatccagatgaaagcggcggcc
gaggttattaaagccaaccatgccctgccctatgccgtgtacgtctccgatccttgtgac
gggcgtactcagggtacaacggggatgtttgattcgctaccataccgaaatgacgcatcg
atggtaatgcgccgccttattcgctctctgcccgacgcgaaagcagttattggtgtggcg
agttgcgataaggggcttccggccaccatgatggcactcgccgcgcagcacaacatcgca
accgtgctggtccccggcggcgcgacgctgcccgcaaaggatggagaagacaacggcaag
gtgcaaaccattggcgcacgcttcgccaatggcgaattatctctacaggacgcacgccgt
gcgggctgtaaagcctgtgcctcttccggcggcggctgtcaatttttgggcactgccggg
acatctcaggtggtggccgaaggattgggactggcaatcccacattcagccctggcccct
tccggtgagcctgtgtggcgggagatcgccagagcttccgcgcgagctgcgctgaacctg
agtcaaaaaggcatcaccacccgggaaattctcaccgataaagcgatagagaatgcgatg
acggtccatgccgcgttcggtggttcaacaaacctgctgttacacatcccggcaattgct
caccaggcaggttgccatatcccgaccgttgatgactggatccgcatcaacaagcgcgtg
ccccgactggtgagcgtactgcctaatggcccggtttatcatccaacggtcaatgccttt
atggcaggtggtgtgccggaagtcatgttgcatctgcgcagcctcggattgttgcatgaa
gacgttatgacggttaccggcagcacgctgaaagaaaacctcgactggtgggagcactcc
gaacggcgtcagcggttcaagcaactcctgctcgatcaggaacaaatcaacgctgacgaa
gtgatcatgtctccgcagcaagcaaaagcgcgcggattaacctcaactatcaccttcccg
gtgggcaatattgcgccagaaggttcggtgatcaaatccaccgccattgacccctcgatg
attgatgagcaaggtatctattaccataaaggtgtggcgaaggtttatctgtccgagaaa
agtgcgatttacgatatcaaacatgacaagatcaaggcgggcgatattctggtcattatt
ggcgttggaccttcaggtacagggatggaagaaacctaccaggttaccagtgccctgaag
catctgtcatacggtaagcatgtttcgttaatcaccgatgcacgtttctcgggcgtttct
actggcgcgtgcatcggccatgtggggccagaagcgctggccggaggccccatcggtaaa
ttacgcaccggggatttaattgaaattaaaattgattgtcgcgagcttcacggcgaagtc
aatttcctcggaacccgtagcgatgaacaattaccttcacaggaggaggcaactgcaata
ttaaatgccagacccagccatcaggatttacttcccgatcctgaattgccagatgatacc
cggctatgggcaatgcttcaggccgtgagtggtgggacatggaccggttgtatttatgat
gtaaacaaaattggcgcggctttgcgcgattttatgaataaaaactga
              
                            

Download fasta file
RegulonDB