RegulonDB RegulonDB 10.9: Gene Sequence
nanC gene sequence


Size: 717        A: 222  T: 187  G: 163  C: 145

Fasta

 

>nanC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaggctaaaatactttctggcgtattattactgtgcttttcgtccccattaatt
tctcaggctgcgacactggacgtacgtggtggatatcgtagtggaagccacgcctatgag
actcgactcaaagtcagtgagggatggcaaaatggatggtgggcaagcatggaaagtaat
acctggaataccattcatgataataaaaaggaaaatgccgcactcaatgatgttcaggtt
gaagttaattacgcgattaaacttgatgatcaatggacggtgcgcccgggaatgttaacg
cattttagcagcaacggcacacgctacggaccctacgtaaaactgtcctgggacgcgaca
aaagatcttaattttggcattcgctatcgttacgactggaaagcttaccgacaacaagac
ttatccggtgatatgtctcgtgataacgttcatcgttgggatggatatgtcacttaccat
attaatagtgatttcaccttcgcatggcaaacgacgctatacagcaaacagaacgattat
cgctatgcaaaccataagaaatgggcgacggaaaatgcatttgttctacaataccatatg
acgcccgatattacgccatacatagaatatgactaccttgaccgtcagggtgtttacaac
ggcagagataatttatcggaaaacagttatcgcattggtgtgtcatttaaactgtag
              
                            

Download fasta file
RegulonDB