RegulonDB RegulonDB 10.10: Gene Sequence
btsT gene sequence


Size: 2151        A: 402  T: 543  G: 611  C: 595

Fasta

 

>btsT E. coli K12. Version NC_000913.3 GI:556503834
atggatactaaaaagatattcaagcacataccctgggtgattctcggaatcatcggtgca
ttctgcctcgcggtagttgcattacgtcggggggagcacatcagcgccctgtggatcgtg
gtcgcctctgtatcggtgtatctggtggcgtatcgctactacagtctgtacatcgcccag
aaggtgatgaaactcgaccccacgcgcgcgacgcctgcggttattaacaacgacggtctg
aactacgttccgaccaaccgttacgtgttgtttggtcaccacttcgccgctatcgccggt
gctggtccgctggtgggtccggttctcgccgcgcagatgggctacctgcctggcacgctg
tggctgctggcgggggtcgtgctggccggtgcggttcaggactttatggtgctgtttatc
tcctctcgccgtaatggcgcatctcttggtgagatgatcaaagaagagatgggaccagta
ccggggactatcgcgctgtttggctgtttcttaatcatgatcatcatcctcgccgtcctg
gcgctgattgtggttaaagccctggccgaaagtccgtggggtgtcttcaccgtttgctca
accgtaccgattgcgctgtttatgggtatctacatgcgctttattcgtccggggcgtgtg
ggtgaagtctctgtcattggtatcgtgctgctggttgcctctatctacttcggtggcgtg
attgctcacgatccgtactggggtccggcactgacctttaaagacaccaccattaccttc
gcgctgattggctatgcgtttgtttccgcactgctgccagtgtggctgatcctcgcaccg
cgcgactatctggcaaccttcctgaaaatcggcgttatcgtcggcctggcgctgggtatc
gtggtgctgaacccggaactgaaaatgcctgccatgacccagtacattgacggtactggc
ccgctgtggaaaggcgctctgttcccgttcctgttcatcaccatcgcctgtggtgcggta
tctggcttccacgcgctgatctcttccggtacgacgccaaaactgctggctaatgaaacc
gacgcgcgtttcatcggctacggcgcaatgctgatggagtccttcgtggcgattatggcg
ctggttgctgcgtccatcatcgaaccgggtctttacttcgcgatgaacaccccgcctgct
ggccttggcatcaccatgcctaacctgcatgaaatgggtggcgagaacgcgccgatcatc
atggcgcagctgaaagacgttaccgcacacgcggcagcgaccgtcagctcctggggcttc
gtgatttcgccagagcagatcctgcaaaccgcgaaagacattggtgagccttctgtcctg
aaccgtgcaggtggcgcgccgacgctggcggtaggtatcgcgcacgtgttccacaaagtg
ctgccgatggctgacatgggcttctggtatcacttcggtattctgttcgaagccctgttc
atcctgaccgcgctggatgcgggtacccgttctggccgctttatgctgcaagacctgctg
ggtaacttcatcccgttcctgaaaaaaaccgattctctggttgccggtatcatcggtact
gcgggctgtgtgggtctgtggggctacctgctgtatcagggcgtggttgatccgctgggc
ggcgttaagagcctgtggccgctgttcggtatctccaaccagatgctggcagccgtagcg
ctggtactgggcaccgttgtgctgattaagatgaagcgcacccaatacatctgggtaact
gttgttccggctgtatggctgcttatctgcaccacctgggcgctgggcctgaaactgttc
agcaccaacccgcagatggaaggcttcttctacatggcaagccagtacaaagagaagatt
gctaacggtactgacctgacggcgcagcagattgccaatatgaaccacatcgttgtgaac
aactacaccaacgcaggtctgagtattctgttcctgattgtggtgtacagcatcatcttc
tacggtttcaaaacctggcttgcggtgcgtaacagcgacaaacgtactgacaaagaaaca
ccgtacgttccaatcccggaaggcggcgtgaagatctcttcgcaccactaa
              
                            

Download fasta file
RegulonDB