RegulonDB RegulonDB 10.10: Gene Sequence
bglJ gene sequence


Size: 678        A: 183  T: 188  G: 171  C: 136

Fasta

 

>bglJ E. coli K12. Version NC_000913.3 GI:556503834
atggaacacagccgaattaagaagagaaatgtcgcactcatagaaaaatgcgtcatgagt
agtatcggtattgagagtttattcagaaagtttgcgggtaacccttataagctccatacc
tataccagtcaggagtcatttcaggatgccatgtcgcggatctcgtttgcggcggtcatt
ttttctttttctgccatgagaagtgagcgcagagagggattatcttgcctgactgaactg
gcgattaagtttccgcgtacccggcgtttagttattgcggatgatgatattgaagctcgg
ctgattggttcattgtcgccatcaccgctggacggtgtattaagtaaagcgtcaacgctg
gagatttttcatcaggaactctttttgtcattaaatggtgtacgtcaggcgaccgaccga
ctgaacaatcagtggtacattaaccaaagccggacgttaagcccgacggagagagaaata
ttgcgctttatgtcgcgtggctactcaatgacacaaattgccgagcagcttaaacgcaat
atcaaaacgatccgtgcacataaatttaatgtgatgtcgaaactgggcgtcagttctgac
gcagggttgttggaggccgcagatattctgttatgtatgcggcattgcgaaacaagtaat
gtgttgcatccctattaa
              
                            

Download fasta file
RegulonDB