RegulonDB RegulonDB 10.9: Gene Sequence
fhuF gene sequence


Size: 789        A: 189  T: 181  G: 207  C: 212

Fasta

 

>fhuF E. coli K12. Version NC_000913.3 GI:556503834
atggcctatcgttccgcaccgctctatgaagatgtcatctggcgaacgcatctccagccg
caggatcccacgcttgcgcaagccgtgcgggcgacgatcgcaaaacatcgtgaacatttg
ctggagtttatccgcctggatgaacctgccccacttaacgccatgacgctggcgcaatgg
tcatcaccgaatgtgctaagttctctgctggcggtctattccgatcatatctatcgcaac
caaccgatgatgatccgcgagaacaaaccgctgatctcactatgggcacaatggtatatc
ggcctgatggtgccaccattaatgctggcgctactgacgcaggaaaaggcattagatgtg
tcgccggaacatttccatgctgagtttcacgaaaccggacgcgtcgcctgtttctgggtc
gatgtgtgtgaagataaaaacgcaacaccacattcgccgcagcatcgaatggaaacgtta
atcagccaggcgctggttccggttgtgcaagcactagaagcgaccggagagatcaacggc
aaacttatctggagtaataccggttatttgatcaactggtatctcactgagatgaagcaa
ctgctcggcgaggctactgttgaatcgctgcgccatgccctcttttttgagaaaacgctc
acgaacggtgaagataatccactctggcgtaccgtggtactgcgcgacggcctgctggtg
cgccgcacttgctgccagcgttatcgcttaccggatgtgcagcaatgtggcgattgtacg
ctgaaatga
              
                            

Download fasta file
RegulonDB