RegulonDB RegulonDB 10.8: Gene Sequence
null gene sequence


Size: 222        A: 68  T: 53  G: 66  C: 35

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
gtgaaagaagcggtccagatatatgggggaatccgttctatcatcaatatctttgtgtcc
cagatggtaaaggggactatacttgtggtggccaagaccaacggggagaatcaaaaggag
atggtctatgggggccaggtaaagcaagtaatgatacaaaagaagctgctggccgttgtg
acctcgttgaaaccgataatagttgtgtggagaactgtttaa
              
                            

Download fasta file
RegulonDB