RegulonDB RegulonDB 10.10: Gene Sequence
ilvG gene sequence


Size: 1645        A: 374  T: 372  G: 465  C: 434

Fasta

 

>ilvG E. coli K12. Version NC_000913.3 GI:556503834
atgaatggcgcacagtgggtggtacatgcgttgcgggcacagggtgtgaacaccgttttc
ggttatccgggtggcgcaattatgccggtttacgatgcattgtatgacggcggcgtggag
cacttgctatgccgacatgagcagggtgcggcaatggcggctatcggttatgctcgtgct
accggcaaaactggcgtatgtatcgccacgtctggtccgggcgcaaccaacctgataacc
gggcttgcggacgcactgttagattccatccctgttgttgccatcaccggtcaagtgtcc
gcaccgtttatcggcactgacgcatttcaggaagtggatgtcctgggattgtcgttagcc
tgtaccaagcacagctttctggtgcagtcgctggaagagttgccgcgcatcatggctgaa
gcattcgacgttgcctgctcaggtcgtcctggtccggttctggtcgatatcccaaaagat
atccagttagccagcggtgacctggaaccgtggttcaccaccgttgaaaacgaagtgact
ttcccacatgccgaagttgagcaagcgcgccagatgctggcaaaagcgcaaaaaccgatg
ctgtacgttggcggtggcgtgggtatggcgcaggcagttccggctttgcgtgaatttctc
gctgccacaaaaatgcctgccacctgtacgctgaaagggctgggcgcagtagaagcagat
tatccgtactatctgggcatgctggggatgcacggcaccaaagcggcaaacttcgcggtg
caggagtgtgacctgctgatcgccgtgggcgcacgttttgatgaccgggtgaccggcaaa
ctgaacaccttcgcgccacacgccagtgttatccatatggatatcgacccggcagaaatg
aacaagctgcgtcaggcacatgtggcattacaaggtgatttaaatgctctgttaccagca
ttacagcagccgttaaatcaatgactggcagcaacactgcgcgcagctgcgtgatgaaca
ttcctggcgttacgaccatcccggtgacgctatctacgcgccgttgttgttaaaacaact
gtcggatcgtaaacctgcggattgcgtcgtgaccacagatgtggggcagcaccagatgtg
ggctgcgcagcacatcgcccacactcgcccggaaaatttcatcacctccagcggtttagg
taccatgggttttggtttaccggcggcggttggcgcacaagtcgcgcgaccgaacgatac
cgttgtctgtatctccggtgacggctctttcatgatgaatgtgcaagagctgggcaccgt
aaaacgcaagcagttaccgttgaaaatcgtcttactcgataaccaacggttagggatggt
tcgacaatggcagcaactgttttttcaggaacgatacagcgaaaccacccttactgataa
ccccgatttcctcatgttagccagcgccttcggcatccatggccaacacatcacccggaa
agaccaggttgaagcggcactcgacaccatgctgaacagtgatgggccatacctgcttca
tgtctcaatcgacgaacttgagaacgtctggccgctggtgccgcctggcgccagtaattc
agaaatgttggagaaattatcatga
              
                            

Download fasta file
RegulonDB