RegulonDB RegulonDB 10.8: Gene Sequence
hcaE gene sequence


Size: 1362        A: 324  T: 317  G: 371  C: 350

Fasta

 

>hcaE E. coli K12. Version NC_000913.3 GI:556503834
atgaccacaccctcagatttgaacatttaccaactgattgacacccaaaatggtcgggtc
actccgcgtatttataccgacccggatatttaccaactggagcttgagcgtattttcggt
cgttgctggctatttctcgcccacgaaagccagatcccaaaacccggtgatttctttaac
acctacatgggagaagatgcggttgtcgtagtgcgtcagaaagacggcagcatcaaggcg
tttctcaaccaatgccgccaccgggccatgcgtgtgagttatgcagattgcggcaacact
cgcgcctttacctgcccgtatcacggctggtcttatggcattaacggcgagttgatcgat
gtaccgctggaacctcgcgcctacccacaagggttgtgtaaatcccactggggactaaac
gaagttccttgtgtggagagttataaagggctaatttttggcaactgggataccagcgca
ccgggcctgcgtgattacctgggtgacattgcctggtatctggatggcatgctggatcgt
cgcgaaggcggcaccgaaattgtcggcggcgtacaaaagtgggtgatcaactgtaactgg
aaattcccggcagagcagttcgccagtgaccagtatcatgctctgttcagccatgcttct
gccgttcaggtattaggggcgaaagatgatggcagcgataagcgcctcggtgatggacaa
accgcccgcccggtgtgggaaaccgccaaagatgcgctgcaatttggtcaggacggtcac
ggtagcggtttcttctttactgaaaaaccggatgctaatgtctgggtcgatggcgcagtt
tcaagctattaccgcgaaacctatgccgaagcagaacaacgtttaggtgaagttcgcgcc
ctgcgcctggcgggtcataacaatattttccccacgctttcatggctaaacggcactgcc
acactccgcgtctggcatccgcgcggccctgatcaagttgaagtgtgggcgttctgtatt
actgacaaagccgcctccgatgaagttaaagccgcttttgaaaacagcgccactcgtgct
tttggtcctgctggttttctcgagcaggatgactcggagaactggtgtgaaatccagaaa
ttgcttaaaggccaccgcgcccgcaacagcaaactgtgtctggaaatggggcttggtcag
gaaaagcgccgcgacgacggcattcctggcattactaactatatcttttcagaaactgcc
gctcgtggaatgtaccaacgctgggccgatcttctgagtagcgaaagctggcaggaagtg
ctcgataaaaccgccgcttaccagcaggaggtgatgaaatga
              
                            

Download fasta file
RegulonDB